Which of the Following Can Be Translated Into Protein

Antibiotic inhibiting interaction between tRNA and mRNA during protein synthesis in bacteria asked Mar 28 2020 in Biology by Harshitagupta 249k points class-12. The template DNA The promoter The terminator region 13RNA polymerase is guided by the coding strand of DNA.

Pin On Genetics Molecular Biology

While in A there is a stop codon just after the initiation codon the protein translation process will be terminated soon it starts.

. In transcription the DNA sequence of a gene is rewritten in RNA. Template strand of DNA. MRNA tRNA and rRNA are all translated into protein.

Which of the following can be translated into protein. Click to see full answer. Therefore the correct options are B and D.

Translate the following RNA sequence into a protein chain. The mRNA acts as a busboy to carry the information stored in the DNA in the nucleus to the cytoplasm where the ribosomes can make it into protein. In this problem were going to categorize some statements about the central dogma.

MRNA can be translated into a protein. MRNA tRNA and rRNA are all translated into protein. Which of the following can be translated into protein.

Check the news of which of the following are translated into proteins. Get FREE solutions to all questions from chapter GENE ITS EXPRESSION AND REGULATION. Course Title BIOL 2420.

This results in the formation of the mature mRNA that is translated into a protein. Multiple amino acids are changed due to a frameshift mutation. Check All frames to see protein sequences for all frames not just the longest one.

In translation the sequence of nucleotides in the mRNA is translated into a sequence of amino acids in a. Which of the following will be translated into a protein. MRNA tRNA O mRNA RNA and rRNA are all translated into protein.

11Which of the following can be translated into protein. So DNA is sort of the static information holding material. Translate the following mRNA into protein starting from the first initiation codon.

AUGGUUACCAGUCGCUUAUAA Please helenirby1964 helenirby1964 05212020 Chemistry Middle School answered 4. Translate is a tool which allows the translation of a nucleotide DNARNA sequence to a protein sequence. So the central dogma is a concept in microbiology that says that D.

And then translated into proteins. Select your initiator on one of the following frames to retrieve your amino acid sequence. AGACAGACG-AGACGGACG If the mutated DNA were transcribed and translated into a protein which of the following would be true.

Which of the following can be translated into protein tRNA mRNA rRNA mRNA tRNA. A A protein that resides in the chloroplast B A protein that resides between the inner and outer nuclear membranes C A protein that will be secreted into the extracellular space D A protein linked to the plasma. Select all that apply.

School El Centro College. Met Stop spaces between residues Compact. AUGGUUACCAGUCGCUUAUAA Please 1 See answer Advertisement.

Translate the following RNA sequence into a protein chain. TRNA - transfer RNA is a small RNA that has a very specific secondary and tertiary structure such that it can bind an amino acid at one end and mRNA at the other end. For real world proteins the correct frame most often produces the longest peptide sequence but this may not.

A mRNA tRNA and rRNA are all translated into protein. Which of the following can be translated into protein. The exons are the coding regions and the introns are the non-coding regions.

During transcription the complete gene is copied into a pre-mRNA along with exons and introns. The pre-mRNA is processed to form a mature mRNA molecule that can be translated to build the protein molecule polypeptide encoded by the original gene. One amino acid would change due to a substitution.

M RNA is the temporary transcript that is used to get out of the nucleus and then protein is the. The mutation would not affect peptide production. Correct Part E Which of the following can be translated into protein.

In eukaryotes the RNA must go through additional processing steps to become a messenger RNA or mRNA. Watch complete video answer for Which of the following will be translated into a pr of Biology Class 12th. The flow of genetic information in molecular biology follows the following path A DNA is translated into protein B DNA is transcribed into RNA which is translated into protein C DNA is translated into RNA which is transcribed into protein D RNA is transcribed into protein.

One amino acid would change due to an insertion. Pages 16 This preview shows page 3 - 9 out of 16 pages. Hereof how is DNA code translated into proteins.

Checking the sequences given in the question we see only options B and D fulfil this criteria. Is transcribed into M. TRNA a View the full answer Transcribed image text.

B rRNA c tRNA d mRNA. M - no spaces. It acts as an adaptor to carry the amino acid.

DNA or RNA sequence. Check Nucleotide sequence to see the cleaned up sequence used in translation. Which of the following proteins are translated on ribosomes attached to the ER.

All cells can be. Numbers spaces and line ends are ignored. In case C there is no initiation codon and hence this sequence cannot be translated into a protein sequence.

See the answer See the answer done loading. To keep watching this video solution for FREE Download our App. The tool accepts both DNA and RNA sequences.

Which of the following can be translated into protein. MRNA tRNA rRNA 14What is the initial target of RNA polymerase. The process of RNA splicing converts the pre-mRNA to mRNA and involves the removal of introns and the joining of exons.

A Table Lists 64 Different Combinations Of The Nucleotides Uracil U Cytosine C Adenine A And Guanine G Teaching Biology Learning Science Biochemistry

Related Image Endocrine System Hormones Hormones Plasma Membrane

Protein Functions Comprehension Reading Pdf Digital Versions Middle School Science Class Life Science High School Biology

Pin On Protein Synthesis